View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10452_high_2 (Length: 386)
Name: NF10452_high_2
Description: NF10452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10452_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 330
Target Start/End: Complemental strand, 7580219 - 7579913
Alignment:
| Q |
18 |
gaatcagcttcttggatggtagaggttatgttatgggtgggtatattgtatgttttatgttgaatcattggttgtgttgtgtttgattcctaaatcatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7580219 |
gaatcagcttcttggatggtagaggttatgttatgggt----atattgtatgttttatgttgaatcattggttgtgttgtgtttgattcctaaatcatgt |
7580124 |
T |
|
| Q |
118 |
ctaacttgtaatatttgttggctttgaaacgtacaatttgcaggcacttccgataaacctagacaagttgttcaatcagtttgttgttatcattctctat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7580123 |
ctaacttgtaatatttgttggctttgaaacgtacaatttgcaggtacttccgataaacctagacaagttgttcaatcagtttgttgttatcattctctat |
7580024 |
T |
|
| Q |
218 |
gtgatttttgtcctgttttttgggtaggtatgtgannnnnnnnnngtatatacgtttcacatttctagggtttagcatcaatatttgcatccaatgaata |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || | ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7580023 |
gtgatttttgtcctgttttttgggtaggtatgcgattttttttttttgtat--gtttcacatttctagggtttagcatcaatatttgcatccaatgaata |
7579926 |
T |
|
| Q |
318 |
tcataaattcgat |
330 |
Q |
| |
|
|||| || ||||| |
|
|
| T |
7579925 |
tcatgaagtcgat |
7579913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University