View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10452_low_10 (Length: 251)
Name: NF10452_low_10
Description: NF10452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10452_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 41 - 183
Target Start/End: Complemental strand, 29206672 - 29206530
Alignment:
| Q |
41 |
tgtgcgcgcgcgcgtatgtgtgcaagcacattggaaatcttttatacagggagtatggtcgctaaactctttgaaacaaaatttcatatctgtagaattg |
140 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29206672 |
tgtgtgcgcgcgtgtatgtgtgcaagcacattggaaatcttttatgcagggagtatagtcgctaaactctttgaaacaaaatttcatatctgtagaattg |
29206573 |
T |
 |
| Q |
141 |
cactacatttggcaaagccggtctaatgataatcaatgtctaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29206572 |
cactacatttggcaaagccggtctaatgataatcaatgtctaa |
29206530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University