View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10452_low_13 (Length: 240)
Name: NF10452_low_13
Description: NF10452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10452_low_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 240
Target Start/End: Complemental strand, 6163888 - 6163658
Alignment:
| Q |
10 |
atgaaatcatcacctaatgtgaaaagggagatatcacttattgtcaagaatggaagaatgtttatgcttgggcacgccnnnnnnnnnaaatttcaattcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6163888 |
atgaaatcatcacctaatgtgaaaagggagatatcacttattgtcaagaatggaagaatgtttatgcttgggcacgcctttttttttaaatttcaattcc |
6163789 |
T |
|
| Q |
110 |
cttgtatgtatcttgtgatatttttcttgggaaggagaaatccatatcaatttgttgccaatgaacgaagtgtcgtcaatttgaattgttgatgtggtta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6163788 |
cttgtatgtatcttgtgatatttttcttgggaaggagaaatccatatcaatttgttgccaatgaatgaagtgtcgtcaatttgaattgttgatgtggtta |
6163689 |
T |
|
| Q |
210 |
gatacatgtagttttttaagatccaagatca |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6163688 |
gatacatgtagttttttaagatccaagatca |
6163658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University