View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10452_low_14 (Length: 229)
Name: NF10452_low_14
Description: NF10452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10452_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 29206439 - 29206225
Alignment:
| Q |
1 |
aagatcttaatagagaaaaaatttgagttgcagatcaaacagaacagttccaagagaatcatgcattcacatgatgagtagcaagtgctggagctgcacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29206439 |
aagatcttaatagagaaaaaatttgagttgcagatcaaacagaacagttccaagagaatcatgcattcacatgatgagtagcaagtgctggagctgcacc |
29206340 |
T |
|
| Q |
101 |
tctggcaatggattttacaacatgcaccaatgtggtcatcaagctcttaacaaccccattaaatagaagctttatacagttgcgaagagaagcatctata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29206339 |
tctggcaatggattttacaacatgcaccaatgtggtcatcaagctcttaacaaccccattaaatagaagctttatacagttgcgaagagaagcatctata |
29206240 |
T |
|
| Q |
201 |
atgtcacattaattt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29206239 |
atgtcacattaattt |
29206225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 23 - 160
Target Start/End: Original strand, 38379646 - 38379783
Alignment:
| Q |
23 |
ttgagttgcagatcaaacagaacagttccaagagaatcatgcattcacatgatgagtagcaagtgctggagctgcacctctggcaatggattttacaaca |
122 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| | | |||||||||||| ||||||| |
|
|
| T |
38379646 |
ttgagttacagatcaagcagaacagttccaagagaatcatgcatccacatgatgagtagcaagtgttggagctgtgcttttggcaatggattctacaaca |
38379745 |
T |
|
| Q |
123 |
tgcaccaatgtggtcatcaagctcttaacaaccccatt |
160 |
Q |
| |
|
| ||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
38379746 |
ttgaccaatgtggtcatcaaactctcaacaactccatt |
38379783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University