View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10452_low_16 (Length: 226)
Name: NF10452_low_16
Description: NF10452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10452_low_16 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 2064202 - 2063977
Alignment:
| Q |
1 |
ttatgacgttgaaggtaacagaattggtgaagaaattagtgaaatgtttcggtggctttcaggggtatgattggtaaagtacattaacatttaggtttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064202 |
ttatgacgttgaaggtaacagaattggtgaagagattagtgaaatgtttcggtggctttcaggggtatgattggtaaagtacattaacatttaggtttat |
2064103 |
T |
|
| Q |
101 |
aaatttcgatataannnnnnnnnnnnnaatctttgtaaacatttgctactatgttatttggcttcacttttgattttcctttgaggctttagaacaaaat |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064102 |
aaatttcgatataatttttttatttttaatctttgtaaacatttgctactatgttatttggcttcacttttgattttcctttgaggctttagaacaaaat |
2064003 |
T |
|
| Q |
201 |
taatgcaaatgagtagaggtatggtg |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2064002 |
taatgcaaatgagtagaggtatggtg |
2063977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University