View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10452_low_5 (Length: 325)
Name: NF10452_low_5
Description: NF10452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10452_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 315
Target Start/End: Complemental strand, 4316394 - 4316097
Alignment:
| Q |
18 |
gtaattcttgtaaatctatgtgtactgggaaagatggaccttgtctttgtgatacttgggtcttttgtgggaatcgggaggcttgtggatccaaattcgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4316394 |
gtaattcttgtaaatctatgtgtactgggaaagatggaccttgtctttgtgatacatgggtcttttgtgggaatcgggaggcttgtggatccaaattcgg |
4316295 |
T |
|
| Q |
118 |
cgaggtacgttgcccgttcttgtccatagagacactgacgcatgtggttacattcaatcatttctaattttagtgtttaattgtcaatatagtgtcgtgt |
217 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4316294 |
cgaggtactttgcccgttcctgtccatagagacactgacgcatgtggttacattcaatcatttctaattttagtgtttaattgtcaatatagtgtcgtgt |
4316195 |
T |
|
| Q |
218 |
cttgtgtctgtgtcaatcgttccaccttccatttgggtctatccttttggaattggtgttgnnnnnnncttgtttctttcctttgtatagagtctctg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
4316194 |
cttgtgtctgtgtcaatcgttccaccttccatttgggtctatccttttggaattggtgttgtttttttcttgtttctttcctttgtatagagtttctg |
4316097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University