View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10453_high_3 (Length: 204)
Name: NF10453_high_3
Description: NF10453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10453_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 11 - 188
Target Start/End: Original strand, 47193271 - 47193448
Alignment:
| Q |
11 |
agcagagagatcggtcgaggaggaggagggattgtttacaaaggtacactcgatgatgatcgtgttgctgctgttaaatgcttaaatgaagctcatcagg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47193271 |
agcaaagagatcggtcgaggaggaggagggattgtttacaaaggtacactcgatgatgatcgtgttgctgctgttaaatgcttaaatgaagctcatcagg |
47193370 |
T |
|
| Q |
111 |
gagaagctgaatttctagctgaaataagcacaattggtatgttgaaccatatgaatttaattgatatgtggggatatt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47193371 |
gagaagctgaatttctagctgaaataagcacaattggtatgttgaaccatatgaatttaattgatatgtggggatatt |
47193448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 46 - 188
Target Start/End: Original strand, 9792406 - 9792548
Alignment:
| Q |
46 |
ttacaaaggtacactcgatgatgatcgtgttgctgctgttaaatgcttaaatgaagctcatcagggagaagctgaatttctagctgaaataagcacaatt |
145 |
Q |
| |
|
|||||||| ||||||| | ||| |||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
9792406 |
ttacaaagttacactcaacgattatcgtgttgctgctgttaaatgcttaaatgaagctcatcaagaagaagctaaatttctagcttaaataagtacaatt |
9792505 |
T |
|
| Q |
146 |
ggtatgttgaaccatatgaatttaattgatatgtggggatatt |
188 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9792506 |
ggtatgttgaaccataaaaatttaattgatatgtggggatatt |
9792548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 122 - 163
Target Start/End: Complemental strand, 6609524 - 6609483
Alignment:
| Q |
122 |
tttctagctgaaataagcacaattggtatgttgaaccatatg |
163 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
6609524 |
tttctagcttaaataagcaaaattggtatgttaaaccatatg |
6609483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 188
Target Start/End: Complemental strand, 18658897 - 18658801
Alignment:
| Q |
92 |
ttaaatgaagctcatcagggagaagctgaatttctagctgaaataagcacaattggtatgttgaaccatatgaatttaattgatatgtggggatatt |
188 |
Q |
| |
|
|||||||||||| | || ||||||| |||||||| |||||| |||||| ||||| | | ||||| ||||| || ||||||||||||||||||| |
|
|
| T |
18658897 |
ttaaatgaagctaaacaaggagaaggagaatttcttgctgaagtaagcatcattggacggcttaaccacatgaacttgattgatatgtggggatatt |
18658801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University