View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10453_low_3 (Length: 251)
Name: NF10453_low_3
Description: NF10453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10453_low_3 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 36580224 - 36579984
Alignment:
| Q |
11 |
caaaggttttggtagaaatattttgttggctggtgtatttttattttnnnnnnnn-cttgtcacaactcaactaaaaaaggatttggagttgtcatgaac |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36580224 |
caaaggttttggtagaaatattttgttggctggtgtatttttattttaaaaaaaaacttgtcacaactcaactaaaaaaggatttggagttgtcatgaac |
36580125 |
T |
 |
| Q |
110 |
tttaaagttttgtgtagtgaaaaccnnnnnnnnnngatttggattaatcactatcagtttttagtttaaaatgatatgacaatcgaacaaaaagaggttt |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36580124 |
tttaaagttttgtgtagtgaaaaccaaaaaaaaa-gatttggattaatcactatcagtttttagtttaaaatgatatgacaatcgaacaaaaagaggttt |
36580026 |
T |
 |
| Q |
210 |
tggagttgtcatcaattttaaaacttgtacaagaatcaaacc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36580025 |
tggagttgtcatcaattttaaaacttgtacaacaatcaaacc |
36579984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University