View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10453_low_6 (Length: 212)
Name: NF10453_low_6
Description: NF10453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10453_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 28187358 - 28187177
Alignment:
| Q |
19 |
gtatggtggtcatgatgatagggaagaagatgaagccaaaatggggttcattttccgaataaatgagcatggctttggtactcaattacatgaagaaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28187358 |
gtatggtggtcatgatgatagggaagaagatgaagccaaaatggggttcattttccgaataaatgagcatggctttggtactcaattacatgaagaaaag |
28187259 |
T |
 |
| Q |
119 |
ggacaaaataagggacctaacctcattgactatttacctctttcatcttcattatctctataattttccatttgcttcttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28187258 |
ggacaaaataagggacctaacctcattgactatttacctctttcatcttcattatctctataattttccatttgcttcttct |
28187177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University