View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10453_low_7 (Length: 204)

Name: NF10453_low_7
Description: NF10453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10453_low_7
NF10453_low_7
[»] chr3 (2 HSPs)
chr3 (11-188)||(47193271-47193448)
chr3 (46-188)||(9792406-9792548)
[»] chr7 (2 HSPs)
chr7 (122-163)||(6609483-6609524)
chr7 (92-188)||(18658801-18658897)


Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 11 - 188
Target Start/End: Original strand, 47193271 - 47193448
Alignment:
11 agcagagagatcggtcgaggaggaggagggattgtttacaaaggtacactcgatgatgatcgtgttgctgctgttaaatgcttaaatgaagctcatcagg 110  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47193271 agcaaagagatcggtcgaggaggaggagggattgtttacaaaggtacactcgatgatgatcgtgttgctgctgttaaatgcttaaatgaagctcatcagg 47193370  T
111 gagaagctgaatttctagctgaaataagcacaattggtatgttgaaccatatgaatttaattgatatgtggggatatt 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47193371 gagaagctgaatttctagctgaaataagcacaattggtatgttgaaccatatgaatttaattgatatgtggggatatt 47193448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 46 - 188
Target Start/End: Original strand, 9792406 - 9792548
Alignment:
46 ttacaaaggtacactcgatgatgatcgtgttgctgctgttaaatgcttaaatgaagctcatcagggagaagctgaatttctagctgaaataagcacaatt 145  Q
    |||||||| ||||||| | ||| |||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||| ||||||| ||||||    
9792406 ttacaaagttacactcaacgattatcgtgttgctgctgttaaatgcttaaatgaagctcatcaagaagaagctaaatttctagcttaaataagtacaatt 9792505  T
146 ggtatgttgaaccatatgaatttaattgatatgtggggatatt 188  Q
    ||||||||||||||||  |||||||||||||||||||||||||    
9792506 ggtatgttgaaccataaaaatttaattgatatgtggggatatt 9792548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 122 - 163
Target Start/End: Complemental strand, 6609524 - 6609483
Alignment:
122 tttctagctgaaataagcacaattggtatgttgaaccatatg 163  Q
    ||||||||| ||||||||| |||||||||||| |||||||||    
6609524 tttctagcttaaataagcaaaattggtatgttaaaccatatg 6609483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 188
Target Start/End: Complemental strand, 18658897 - 18658801
Alignment:
92 ttaaatgaagctcatcagggagaagctgaatttctagctgaaataagcacaattggtatgttgaaccatatgaatttaattgatatgtggggatatt 188  Q
    |||||||||||| | || |||||||  |||||||| |||||| ||||||  |||||   | | ||||| ||||| || |||||||||||||||||||    
18658897 ttaaatgaagctaaacaaggagaaggagaatttcttgctgaagtaagcatcattggacggcttaaccacatgaacttgattgatatgtggggatatt 18658801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University