View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10454_low_11 (Length: 284)
Name: NF10454_low_11
Description: NF10454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10454_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 7e-86; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 6 - 182
Target Start/End: Complemental strand, 9988085 - 9987909
Alignment:
| Q |
6 |
gagagagaagaaaatgacgagatagacacataaagtgaagtcgattattcaaattcgataatattgtaggaaaatagcgggataaacttccttgttaggg |
105 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9988085 |
gagagagaagaaaatgactagataaacacataaagtgaagtcgattattcaaattcgataatattgtaggaaaatagcgggataaacttccttgttaagg |
9987986 |
T |
 |
| Q |
106 |
gctctctcgtaaatgaatgtaaacaaaccagttctcattttaatcatgttgtttttgctcatattagatgagaagtt |
182 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9987985 |
gctctctcgtaaatgaatgtaaactaaccagttctcattttaatcatgttgtttttgctcatattagatgagaagtt |
9987909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 153 - 222
Target Start/End: Complemental strand, 9987911 - 9987842
Alignment:
| Q |
153 |
gttgtttttgctcatattagatgagaagttaatcaaacggctcattatttagctaagtttgcaattgata |
222 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9987911 |
gttgtttttgctcagattagatgagaagttaatcaaacggctcattatttagctaagtttgcaattgata |
9987842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 222 - 271
Target Start/End: Complemental strand, 9987816 - 9987767
Alignment:
| Q |
222 |
agaaactccttcttgtattgacacggttgtggcttttgatatgatgtcca |
271 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9987816 |
agaaactcctccttatattgacacggttgtggcttttgatatgatgtcca |
9987767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 20781967 - 20782021
Alignment:
| Q |
163 |
ctcatattagatgagaagttaatcaaacggctcattatttagctaagtttgcaat |
217 |
Q |
| |
|
||||| ||||| |||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
20781967 |
ctcatgttagaagagaagctaatcaagctgctcattatttagctaagtttgcaat |
20782021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University