View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10456_high_33 (Length: 205)
Name: NF10456_high_33
Description: NF10456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10456_high_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 11 - 188
Target Start/End: Complemental strand, 50671153 - 50670977
Alignment:
| Q |
11 |
gtgagatgaagatatgtgatttgttgatggattcaaagttgt---agcataaaagaaatcgtaggttgtggaccttatggtttcatttctcaattgttgt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50671153 |
gtgaaatgaagatatgtgatttgttgatggattcaaagttgttgtagcataaaagaaatcgtaggttgtggaccttatggtttcatttctcaattgttgt |
50671054 |
T |
 |
| Q |
108 |
aaagtcttccaccaagtagagaggttaaattgacaaaagaaactatcatcagtgtcatatgggcttataacggcagacata |
188 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
50671053 |
aaagtcttccgccaagtagagaggttaaattgacaaaagaaactat----agtgtcatatgggcttataatggcagacata |
50670977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University