View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10456_high_33 (Length: 205)

Name: NF10456_high_33
Description: NF10456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10456_high_33
NF10456_high_33
[»] chr1 (1 HSPs)
chr1 (11-188)||(50670977-50671153)


Alignment Details
Target: chr1 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 11 - 188
Target Start/End: Complemental strand, 50671153 - 50670977
Alignment:
11 gtgagatgaagatatgtgatttgttgatggattcaaagttgt---agcataaaagaaatcgtaggttgtggaccttatggtttcatttctcaattgttgt 107  Q
    |||| |||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50671153 gtgaaatgaagatatgtgatttgttgatggattcaaagttgttgtagcataaaagaaatcgtaggttgtggaccttatggtttcatttctcaattgttgt 50671054  T
108 aaagtcttccaccaagtagagaggttaaattgacaaaagaaactatcatcagtgtcatatgggcttataacggcagacata 188  Q
    |||||||||| |||||||||||||||||||||||||||||||||||    |||||||||||||||||||| ||||||||||    
50671053 aaagtcttccgccaagtagagaggttaaattgacaaaagaaactat----agtgtcatatgggcttataatggcagacata 50670977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University