View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10456_low_21 (Length: 302)
Name: NF10456_low_21
Description: NF10456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10456_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 22 - 294
Target Start/End: Complemental strand, 47695317 - 47695045
Alignment:
| Q |
22 |
gatttaaagctttcgaaaccatagatttcaaggaccccgatcaaagatttagaattggcatcttgtccaattgaattgttaatcttgtccaccaacctgt |
121 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47695317 |
gatttaaagctttcgaaaccatagatatcaaggaccccgatcaaagatttagaattggcatcttgtccaattgaattgttaatcttgtccaccaacctgt |
47695218 |
T |
 |
| Q |
122 |
taacaaccatgttagtgcaccaaggatcaaaaccatagtccaagattcctgccttatgaatttgtagtccgaactagaattacgaaggacggcactatag |
221 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47695217 |
taacaaccatgttaatgcaccaaggatcaaaaccatagtccaagatccctgccttatgaatttgtagtccgaactagaattacgaaggacggcactatag |
47695118 |
T |
 |
| Q |
222 |
attggtttccattttcagcatcttaccagtcaaagagcctagaatacattgtttttgcgaagccatctctgct |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47695117 |
attggtttccattttcagcatcttaccagtcaaagagcctagaatacattgtttttgcgaagccatctctgct |
47695045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 23 - 115
Target Start/End: Original strand, 35830579 - 35830671
Alignment:
| Q |
23 |
atttaaagctttcgaaaccatagatttcaaggaccccgatcaaagatttagaattggcatcttgtccaattgaattgttaatcttgtccacca |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
35830579 |
atttaaagctttcgaaaccatagatatcaaggaccccaatcaaacatttagaattggggtcttgtccaattgaattattaatcttgtccacca |
35830671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University