View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10456_low_32 (Length: 228)
Name: NF10456_low_32
Description: NF10456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10456_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 35 - 176
Target Start/End: Original strand, 40606669 - 40606809
Alignment:
| Q |
35 |
catagtaaccattgttatgtttcgttaagtgcacttgttgcagtagaaggcactgtgtaatgtggctgatatttttatgtttccttagatcaatcctttt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||||| |
|
|
| T |
40606669 |
catagtaaccattgttatgtttcgttaagtgcacttgttgcagtagaaggcactgtgtaatgtggctggtatttttatgtttcctcatatcaatcctttt |
40606768 |
T |
 |
| Q |
135 |
tttctccatctttttaattgtgactcttgcccaaataaactg |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40606769 |
tttctccatc-ttttaattgtgactcttgcccaaataaactg |
40606809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University