View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10457_high_5 (Length: 297)
Name: NF10457_high_5
Description: NF10457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10457_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 286
Target Start/End: Original strand, 7857201 - 7857469
Alignment:
| Q |
18 |
agtttatgcctttttcgcctatcatattcatcagtcaactagttggatctgtgtagtggcaatatgttgtggttttgctctgattttgttttgcttattc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7857201 |
agtttatgcctttttcgcctatcatattcatcagtcaactagttggatctgtgtagtggcaatatgttgtggttttgctctgattttgttttgcttattc |
7857300 |
T |
 |
| Q |
118 |
tggtttgtctactctgaggccctatatcggattttgttgcttgtttgctgcagctaaagtttgaggtaccggctgctgatgagaaacaagaactgctgaa |
217 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7857301 |
tggtttatctactctgaggccttatatcggattttgttgcttgtttgctgcagctaaagtttgaggtaccggctgctgatgagaaacaagaactgctgaa |
7857400 |
T |
 |
| Q |
218 |
gaattatataaggtgggagagaaacatgcaaagtttataaatatgcttattttttgtctcaatattcat |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7857401 |
gaattatataaggtgggagagaaacatgcaaagtttataaatatgcttattttttgtctcaatattcat |
7857469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University