View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10458_high_12 (Length: 248)
Name: NF10458_high_12
Description: NF10458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10458_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 229
Target Start/End: Complemental strand, 41639263 - 41639043
Alignment:
| Q |
9 |
gaggagcagagacaaattacaactttcatttaacacaaacacattgtgatacagtaatcctgtagcagaaaggttatgcttttgaacaagaaaattagta |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41639263 |
gaggagaagagacaaattacaactttcatttaacagaaacacattgtgatacagtaatcctgtagaagaaaggttatgcttttgaacaagaaaattagta |
41639164 |
T |
|
| Q |
109 |
aaacatgacatgacaactctaggctgctagggaagaaaaaatcgaaatccttttaatattcttcgttgtatgtnnnnnnncaatgtgtactcccaaaaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
41639163 |
aaacatgacatgacaactctaggctgctagggaagaaaaaatcgaaatccttttaatattcttcattgtatgtaaaaaaacaatgtgtactcccaaaaaa |
41639064 |
T |
|
| Q |
209 |
ttcggtgaactaggcttgaga |
229 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41639063 |
ttcggtgaactaggcttgaga |
41639043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University