View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10458_low_12 (Length: 305)
Name: NF10458_low_12
Description: NF10458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10458_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 200 - 287
Target Start/End: Original strand, 14308727 - 14308814
Alignment:
| Q |
200 |
ttcaattaaatcttctatataatttactttgagctcattatcatgagtaatatctcttgaaatgttttaactgtttctaccaatttac |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14308727 |
ttcaattaaatcttctatataatttactttgagctcattatcatgagtgatatctcttgaaatgttttaactgtttctaccaatttac |
14308814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University