View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10458_low_12 (Length: 305)

Name: NF10458_low_12
Description: NF10458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10458_low_12
NF10458_low_12
[»] chr5 (1 HSPs)
chr5 (200-287)||(14308727-14308814)


Alignment Details
Target: chr5 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 200 - 287
Target Start/End: Original strand, 14308727 - 14308814
Alignment:
200 ttcaattaaatcttctatataatttactttgagctcattatcatgagtaatatctcttgaaatgttttaactgtttctaccaatttac 287  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
14308727 ttcaattaaatcttctatataatttactttgagctcattatcatgagtgatatctcttgaaatgttttaactgtttctaccaatttac 14308814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University