View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10458_low_17 (Length: 253)
Name: NF10458_low_17
Description: NF10458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10458_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 27145484 - 27145725
Alignment:
| Q |
1 |
taaaaacatttgtttacctttatgaatcaagttataaaactttgacaaataaaatc--aaaaaatttgaatgatggaaatatatagttaatgaaatttga |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27145484 |
taaaaacatttgtttacctttatgaatcaagttataaaact--gacaaataaaatacaaaaaaatttgaatgatggaaata----gttaatgaaatttga |
27145577 |
T |
 |
| Q |
99 |
ggacttatttaggaaacttgttagcaagacaaaaaataaaataacaccctttcggtaggtgaaaaatggggtttataaaaagtgatcgttggggtatata |
198 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27145578 |
ggacttatttaggaaacttgttagcgagacaaaaaataaaataacaccctttcggtaggtgaaaaatggggtttataaaaagtgatggttggggtatata |
27145677 |
T |
 |
| Q |
199 |
tttgatttgctacagtgtttacctacta-ttttgcacttcttctctct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
27145678 |
tttgatttgctacagtgtttacctactatttttgcacttcttgtctct |
27145725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University