View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10458_low_18 (Length: 250)
Name: NF10458_low_18
Description: NF10458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10458_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 37708862 - 37709089
Alignment:
| Q |
1 |
ttaagctgtttaagtnnnnnnnttcaagaaaaaattatatttattgtttttaacatttttagcataatcgttattcctgggatgaatttttagcatttta |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37708862 |
ttaagctgtttaagtaaaaaaattcaagaaaaaattatatttattgtttttaacatttttagcataatcgttattcctgggatgaatttttagcatttta |
37708961 |
T |
 |
| Q |
101 |
cattctggtggtacgtaataatctaaatttttagcattttccggcaatttttgtnnnnnnnttataacattaactatgaagaaaaaataacaacaatttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37708962 |
cattctggtggtacgtaataatctaaatttttagcattttcaggcaatttttgtaaaaaaattataacattaactatgaagaaaaaataataacaatttt |
37709061 |
T |
 |
| Q |
201 |
taaataaatgaatagatatcataaaaag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37709062 |
taaataaatgaatagatatcataaaaag |
37709089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University