View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10458_low_24 (Length: 229)
Name: NF10458_low_24
Description: NF10458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10458_low_24 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 37708129 - 37708351
Alignment:
| Q |
7 |
cacctttattctttttcgtcacatggaaatagatggtcattttcataactacaaatgttgcattgactataaaacaataaatttaaatgagaaacaattg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37708129 |
cacctttattctttttcgtcacatggaaatagatggtcattttcataactacaaatgttgcattgactataaaacaataaatttaaatgagaaacaattg |
37708228 |
T |
 |
| Q |
107 |
atcaaatccattgatttttaggatgcacaaatgatcagaccattgnnnnnnnataattttagattcaatggcttagatttatgaaagacagcctagctac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37708229 |
atcaaatccattgatttttaggatgcacaaatgatcagaccgttgattttttataattttagattcaatggcttagatttatgaaagacagcctagctac |
37708328 |
T |
 |
| Q |
207 |
tagtgtatctccaaaaaatgaaa |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37708329 |
tagtgtatctccaaaaaatgaaa |
37708351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University