View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10458_low_27 (Length: 208)
Name: NF10458_low_27
Description: NF10458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10458_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 55208917 - 55208742
Alignment:
| Q |
19 |
ataacaccatagcttcattttcatgtgcagctctccgccatgattgattctctgtctctagtctcgtcaaaaattgttccaactccatccttttcttcgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55208917 |
ataacaccatagcttcattttcatgtgcagctctccgccatgattgattctctgtctctagtcttgtcaaaaattgttccaactccatccttttcttcgt |
55208818 |
T |
|
| Q |
119 |
cgcttgtgcaatttgttcatccttttgtcttagtatatgaaacacatcatattccaccttcttcaatattgtcctt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
55208817 |
cgcttgtgcaatttgttcatccttttgtcttagtatatgaaacacatcatattctaccttcttcaatattgtcctt |
55208742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 21 - 192
Target Start/End: Complemental strand, 13135383 - 13135212
Alignment:
| Q |
21 |
aacaccatagcttcattttcatgtgcagctctccgccatgattgattctctgtctctagtctcgtcaaaaattgttccaactccatccttttcttcgtcg |
120 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||||| |||||| ||||| |||||||| |||| |||||||||| ||||| ||||||||| |||| |
|
|
| T |
13135383 |
aacaccatagcttcattttcccgagaagctctccgccacatttgattatctgtttctagtctgatcaagaattgttccagctccaaccttttctttgtcg |
13135284 |
T |
|
| Q |
121 |
cttgtgcaatttgttcatccttttgtcttagtatatgaaacacatcatattccaccttcttcaatattgtcc |
192 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||| ||| |||| ||||||||||||| ||||| |
|
|
| T |
13135283 |
cttgtgctatttgttcatccttttgtcttagtatatgacacatatccgattctaccttcttcaataatgtcc |
13135212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University