View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10459_low_12 (Length: 229)
Name: NF10459_low_12
Description: NF10459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10459_low_12 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 28488915 - 28489136
Alignment:
| Q |
7 |
ataaggacattgtgacctttcagtttcttgaagtttcttttgccaccgtatatcatcgataatagtttcgccctttgcaaaagtcttctgaaagtccaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28488915 |
ataaggacattgtgacctttcagtttcttgaagtttcttttgccaccgtatatcatcgataatactttcgccctttgcaacagtcttctgaaagtccaag |
28489014 |
T |
 |
| Q |
107 |
ggtatttaccaacaaaaccggagtatcataatgaatgaacatttttcctaaaatcttacttgtaattagttgttgagaaatgcttacaagccctattagg |
206 |
Q |
| |
|
| |||||| ||| ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28489015 |
g-tatttaacaataaaaccggagtattgtaatgaatgaacagttttcctaaaatcttacttgtaattagttgttgagaaatgcttacaagccctattagg |
28489113 |
T |
 |
| Q |
207 |
agttttaaggtattgtttaaaca |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28489114 |
agttttaaggtattgtttaaaca |
28489136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 7 - 93
Target Start/End: Original strand, 28477254 - 28477340
Alignment:
| Q |
7 |
ataaggacattgtgacctttcagtttcttgaagtttcttttgccaccgtatatcatcgataatagtttcgccctttgcaaaagtctt |
93 |
Q |
| |
|
||||| || |||||||||||| ||| |||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||| |
|
|
| T |
28477254 |
ataagcacgttgtgacctttcggttgcttgaagtttcttttgccaccgtatagcatcgataatactttcgccttttgcaaaagtctt |
28477340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University