View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10459_low_14 (Length: 205)
Name: NF10459_low_14
Description: NF10459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10459_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 19822212 - 19822038
Alignment:
| Q |
1 |
acggttttttcaaattttaaaagagagtgtaggaaaaagtagaaaccaaataatgcttttcaaattaatccatagctaataaaacctcatccaaatattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19822212 |
acggttttttcaaattttaaaagagagtgtaggaaaaagtagaaaccaaataatgcttttcaaattaatacatagctaataaaacctcatccaaatattc |
19822113 |
T |
|
| Q |
101 |
ttttagtttgaatcagccttttagttttatcaatgttttattttgcatttcacacaaagtttagcagaggattgg |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19822112 |
ttttagtttgaatcagccttttagttttatcaatgttttattttgcatttcacacaaagtttagcagaggattgg |
19822038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 109
Target Start/End: Complemental strand, 2973043 - 2972981
Alignment:
| Q |
47 |
caaataatgcttttcaaattaatccatagctaataaaacctcatccaaatattcttttagttt |
109 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | |||||| |||| |||||| |||| |||| |
|
|
| T |
2973043 |
caaataatgcttttcaaattagtccatagctgagaaaaccccatcttaatattgttttggttt |
2972981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University