View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10460_high_18 (Length: 250)
Name: NF10460_high_18
Description: NF10460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10460_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 38261314 - 38261550
Alignment:
| Q |
1 |
aaggataaattattattaagaaaatgaagcaagcaaagggaataatgctttaaccttttgtcagtaattatgaagtacaaaacaaaatacttccaaacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38261314 |
aaggataaattattattaagaaaatgaagcaagcaaagggaataatgctttaaccttttgtcagtaattatgaagtacaaaacaaaatacttccaaacct |
38261413 |
T |
 |
| Q |
101 |
aaaagcaaaagctgtggtttctcttctctttttgcacctttcttcatagaattgaagagggtattgatcatattatgttaaaagttgtagctgatgacgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38261414 |
aaaagcaaaagctgtggtttctcttctctttttgcacctttcttcatagaattgaagagggtattgatcatattatgttaaaagttgtagctgatgacgt |
38261513 |
T |
 |
| Q |
201 |
atataagcacgctcatttcagcaaaagctcccattct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38261514 |
atataagcacgctcatttcagcaaaagctcccattct |
38261550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University