View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10460_low_21 (Length: 293)

Name: NF10460_low_21
Description: NF10460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10460_low_21
NF10460_low_21
[»] chr1 (1 HSPs)
chr1 (1-40)||(47686837-47686876)


Alignment Details
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 47686837 - 47686876
Alignment:
1 cattttattgtttcccctttgattacttctactagattca 40  Q
    ||||||||||||||||||||||||||||||||||||||||    
47686837 cattttattgtttcccctttgattacttctactagattca 47686876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University