View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10460_low_29 (Length: 246)
Name: NF10460_low_29
Description: NF10460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10460_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 10 - 231
Target Start/End: Complemental strand, 41275604 - 41275383
Alignment:
| Q |
10 |
gatgaaggtgagaaggaggtgaagagtgaagttgttttgaatttgagtgttgttgggttctgtttgaatgtgtgcatgcatgggacaatagagattgaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41275604 |
gatgaaggtgagaaggaggtgaagagtgaagttgttttgaatttgagtgttgttgggttctgtttgaatgtgtgcatgcatgggacaatagagattgaaa |
41275505 |
T |
|
| Q |
110 |
aggcaatgagggaacttgttcaatgggagaatccctctagcagtatttaatttgtgtctgcatgctctcaacaaatgaaattgatcttgtcaaaaagaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41275504 |
aggcaatgagggaacttgttcaatgggagaatccctctagcagtatttaatttgtgtctgcatgctctcaacaaatgaaattgatcttgtcaaaaagaaa |
41275405 |
T |
|
| Q |
210 |
tgaaatttaaatggttgaatct |
231 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41275404 |
tgaaatttaaatggttgaatct |
41275383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University