View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10460_low_30 (Length: 239)
Name: NF10460_low_30
Description: NF10460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10460_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 38261333 - 38261135
Alignment:
| Q |
1 |
cttaataataatttatcctttttatttcaattgaaattcaaatgttgctcatgtggtgttttagtagaaagagatatccttttattttattttgt--agc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
38261333 |
cttaataataatttatcctttttatttcaattgaaattcaaatgttgctcatgtggtgttttagtagaaagagatatccttttattttattttgtaaatc |
38261234 |
T |
 |
| Q |
99 |
gag--tatatctgcatgcgattgcaatgattagtccatcgaatcaatatgataataagtggcatttattccacatattgcagatttaaggtcccacgtc |
195 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38261233 |
gagtatatatctgcatgcgattgcaatgattagtccatcgaatcaatatgataataagtggcatttattccacatattgcagatttaaggtcccacgtc |
38261135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University