View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10460_low_32 (Length: 236)
Name: NF10460_low_32
Description: NF10460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10460_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 53 - 159
Target Start/End: Original strand, 46292333 - 46292439
Alignment:
| Q |
53 |
gaagataacgatagtagaggatctagacgagacttatagcgagaatgaacatgacatttgtgatccttcatactaacttgttgttcaatatagaagatga |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46292333 |
gaagataacgatagtagaggatctagacgagacttatagcgagaatgaacatgacatttgtgatccttcatactaacttgttgttcaatatagaagatga |
46292432 |
T |
 |
| Q |
153 |
ttccctc |
159 |
Q |
| |
|
||||||| |
|
|
| T |
46292433 |
ttccctc |
46292439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University