View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10461_low_15 (Length: 311)
Name: NF10461_low_15
Description: NF10461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10461_low_15 |
 |  |
|
| [»] scaffold0197 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0197 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 3415 - 3126
Alignment:
| Q |
1 |
ccaactgaccaagttctagttcaacaagagagtgacatgacaacatttgatgctgatggaaagaatcatatgcttgaatcacaacaagacatgatggtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3415 |
ccaactgaccaagttctagttcaacaagagagtgacatgacaacatttgatgctgatggaaagaatcatatgcttgaatcacaacaagacatgatggtgt |
3316 |
T |
 |
| Q |
101 |
tttcatgcttggaccaacaaggtatggttggtgagtttccaatggattttcaattagaaggatttgaagctatggtaagtggaggagagggtagtagtag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3315 |
attcatgcttggaccaacaaggtatggttggtgagtttccaatggattttcaattagaaggatttgaagctatggtaagtggaggagagggtagtagtag |
3216 |
T |
 |
| Q |
201 |
ccaatggaattgggaggatttgctcttagatatggatctatataatggtttttcttagattattgttccttattgccaatagggaagaca |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3215 |
ccaatggaattgggaggatttgctcttagatatggatctatataatggtttttcttagattattgttccttattgccaatagggaagaca |
3126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University