View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10461_low_22 (Length: 248)
Name: NF10461_low_22
Description: NF10461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10461_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 117 - 228
Target Start/End: Original strand, 15116259 - 15116369
Alignment:
| Q |
117 |
tgaaaaattagtaaatacctaacaaaaagaagaaacatcgaatttttattttagtaaacatctattgattctacaacaaagcaaagggtatcttcgtcac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
15116259 |
tgaaaaattagtaaatacctaacaaaaagaa-aaacgtcgaatttttattttagtaaacatctagtgattctacatcaaagcaaagggtatcttcatcac |
15116357 |
T |
|
| Q |
217 |
tttggcaaggac |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15116358 |
tttggcaaggac |
15116369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 173 - 221
Target Start/End: Complemental strand, 49676899 - 49676851
Alignment:
| Q |
173 |
aacatctattgattctacaacaaagcaaagggtatcttcgtcactttgg |
221 |
Q |
| |
|
|||||||| ||||||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
49676899 |
aacatctagtgattctgcaacaatgcaaagggtatcttcttcactttgg |
49676851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University