View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10461_low_23 (Length: 248)
Name: NF10461_low_23
Description: NF10461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10461_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 36228034 - 36227805
Alignment:
| Q |
18 |
agaagtgtttgccaatagttccattcatgattttaccgagcttaattccttgttaaacacttcaacttgtaactaagtgattggcctctgtcgttaatga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36228034 |
agaagtgtttgccaatagttccattcatgattttaccgagcttaattccttgttaaacacttcaacttgtaactaagtgattggcctctgtggttaatga |
36227935 |
T |
|
| Q |
118 |
gctgcaattaaggacaaatccttcaggacgaattgagttcaaacttttgaaaacagcttatgagttatgacaatttcataag-nnnnnnnnnnaacttat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36227934 |
gctgcaattaaggacaaatccttcaggacgaattgagttcaaacttttgaacacagcttatgagttatgacaatttcataagtttttttttttaacttat |
36227835 |
T |
|
| Q |
217 |
ttcataagttcttcaatatggcttataaaa |
246 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
36227834 |
ttcataagttcttcaatatagcttataaaa |
36227805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University