View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10461_low_25 (Length: 242)
Name: NF10461_low_25
Description: NF10461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10461_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 4 - 231
Target Start/End: Complemental strand, 493501 - 493274
Alignment:
| Q |
4 |
atcattgttttgggtatttaacatgatgtttgacttgtgtaacttactattttataggttaccttacaattggaacccctcttcaagcgatctattacgt |
103 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
493501 |
atcattgttttgggtttttaacatgatgtttgacttgtgtaacttgctattttataggttaccttacaattggaacccctcttcaaacgatctcttacgt |
493402 |
T |
 |
| Q |
104 |
atttgacaaaaaacgatactgatttgggtgatgaattgatcacttttggcaacaagcatgaatttgccgatgtaacatggtatccaagtcaacaaaaggt |
203 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
493401 |
atttgacaaaaaacgattctgatttgggtgatgaattgatcacttttggtaaaaagcatgaatttgccgatgtaacatggtatccaagtcaacaaaaggt |
493302 |
T |
 |
| Q |
204 |
tctttatagaattgatgatcgtgtctct |
231 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
493301 |
tctttatagaattgatgatcgtgtctct |
493274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University