View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10463_high_3 (Length: 250)
Name: NF10463_high_3
Description: NF10463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10463_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 37227357 - 37227592
Alignment:
| Q |
12 |
cgcctcagtcgccggtgttggcgagtgctagcggggattcagatgctatgagtattgaaggggaacaaggaagaaaaacccatgattatggaagactctc |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37227357 |
cgcctcagtcgccggtggtggcgagtgctagcggggattcagatgctatgagtattgaaggggaacaaggaagaaaaacccatgattatggaagactctc |
37227456 |
T |
 |
| Q |
112 |
tcctaagttggttgcaattttggcacagggaagtaaggatttggatggtgtttcgccgttaggttcaaaagctacgcaatcaccaaatggaaatgatatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37227457 |
tcctaagttggttgcaattttggcacagggaagtaaggatttggatggtgtttcgctgttaggttcaaaagctacgcaatcaccaaatggaaatgatatt |
37227556 |
T |
 |
| Q |
212 |
gaggttttacctgatttggcatgttcatctcactcg |
247 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||| |
|
|
| T |
37227557 |
gaggttttacctgatttggcatgttcagctaactcg |
37227592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University