View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10463_low_10 (Length: 229)
Name: NF10463_low_10
Description: NF10463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10463_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 30623568 - 30623752
Alignment:
| Q |
1 |
agcaagaaatagaactccctttggtccctattataagnnnnnnnnttaaatgaataactgaagtatttggtctataatccaagtacaaatgtcattaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30623568 |
agcaagaaatagaactccctttggtccctattataagaaaaaa--ttaaatgaataactgaagtatttggtcgataatccaagtacaaatgtcattaaat |
30623665 |
T |
 |
| Q |
101 |
gaatctaaaaagtgaatttgttcaacccgagagactataaaacaagaggctgcttatatatactagagaaataaaaattgaaacatg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30623666 |
gaatctaaaaagtgaatttgttcaacccgagagactataaaacaagaggctgcttatatatactagacaaataaaaattgaaacatg |
30623752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 170 - 223
Target Start/End: Original strand, 30623780 - 30623833
Alignment:
| Q |
170 |
aataaaaattgaaacatgaaaagaaacaaacatcgcttctcataatcccctttg |
223 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30623780 |
aataaatattaaaacatgaaaagaaacaaacatcgcttctcataatcccctttg |
30623833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University