View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10463_low_11 (Length: 228)
Name: NF10463_low_11
Description: NF10463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10463_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 86 - 210
Target Start/End: Original strand, 6915068 - 6915192
Alignment:
| Q |
86 |
taatatgatatgataaacaatgtgtttcaattttaattattaatatgttatatagcaaaaatagttagctatcaacaatgtgttaatctaaaagaataaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6915068 |
taatatgatatgataaacaatgtgtttaaattttaattattaatatgttatatagcaaaaatagttagctatcaacaatgtgttaatctaaaagaataaa |
6915167 |
T |
|
| Q |
186 |
acagtaaataacatattgttatagg |
210 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6915168 |
acagtaaataacatattgttatagg |
6915192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 6913694 - 6913767
Alignment:
| Q |
1 |
tttttgaatatattattttatctgttttttacatatgtgaactggagtccaaatttctgtacgttgttcatttt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6913694 |
tttttgaatatattattttatctgttttttacatatgtgaactggagtccaaatttctttacgttgttcatttt |
6913767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University