View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10463_low_13 (Length: 207)
Name: NF10463_low_13
Description: NF10463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10463_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 13 - 193
Target Start/End: Original strand, 47875439 - 47875619
Alignment:
| Q |
13 |
catagggaaaagttcattaattgataacaatggcattttgttcaagccaagctcgtatagtatgctactcgttgttcttgtgtttgttattgtttcggta |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47875439 |
catagagaaaagttcattaattgataacaatggcattttgttcaagccaaactcgtatagtatgctactcgttgttcttgtgtttgttattgtttcagta |
47875538 |
T |
 |
| Q |
113 |
tttttctttaactttttggtgcattagaatcttctcttcatctgacctagctaactgtaactttaacagctactgataact |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47875539 |
tttttctttaactttttggtgcattagaatcttctcttcatctgacctagctaactgtaactttaacagctactgataact |
47875619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University