View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10463_low_7 (Length: 240)
Name: NF10463_low_7
Description: NF10463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10463_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 4 - 227
Target Start/End: Complemental strand, 37227078 - 37226855
Alignment:
| Q |
4 |
aattaaaaactaatcaattaactaaacgatattaggttaagactaaccatcactgtcgtcatcagcgttattgctacttccaccgggagaaggagaacca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37227078 |
aattaaaaactaatcaattaactaaacgatattaggttaagactaaccatcactgtcgtcatcagcgttattgctacttccaccgggagaaggagaacca |
37226979 |
T |
|
| Q |
104 |
atcggttgcaggaaggagttccgatgatctacgacttcagcagcgtcatcagtagggttttggcgcggttcaacttcgtcgtcgctgtctccgccgattt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37226978 |
atcggttgcaggaaggagttccgatgatctacgacttcagcagcgtcatcagtagggttttggcgcggttcaacttcgtcgtcgctgtctccgccgattt |
37226879 |
T |
|
| Q |
204 |
taccgaagaagcctagggtatctg |
227 |
Q |
| |
|
||| |||||| ||||||||||||| |
|
|
| T |
37226878 |
tacggaagaaacctagggtatctg |
37226855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University