View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10463_low_9 (Length: 230)
Name: NF10463_low_9
Description: NF10463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10463_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 7286848 - 7287045
Alignment:
| Q |
18 |
gtaataatgttacacattagggattataattgtggtttgctctttgttaattttttgtgaaatattatttttaacttcacatggtgtcatgatagcttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7286848 |
gtaataatgttacacattagggattataattgtggtttactctttgttaattttttgtgaaatattatttttaacttcacatggtgtcctgatagcttct |
7286947 |
T |
|
| Q |
118 |
tggttttggttaaactctagcctagttaaattgtttgttccattgaactggttgccaacaaaagggcttccttggattgttcttttgtaagttctctg |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7286948 |
tggttttggttaaactccagcctagttaaatagtttgttcaattgaagtggttgccaacaaaagggcttccttgggttgttcttttgtaagttctctg |
7287045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 26 - 146
Target Start/End: Complemental strand, 8357343 - 8357227
Alignment:
| Q |
26 |
gttacacattagggattataattgtggtttgctctttgttaattttttgtgaaatattatttttaacttcacatggtgtcatgatagcttcttggttttg |
125 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||| |||| || | ||||||||||||| | |||||| | |||||||||||| |||| |
|
|
| T |
8357343 |
gttacactttagggactataattgtggtttgctctttgttaa-ttttcatg--acattatttttaactccctctggtgtactcatagcttcttggatttg |
8357247 |
T |
|
| Q |
126 |
gttaaactctagcctagttaa |
146 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
8357246 |
gttaaact-tagcctagttaa |
8357227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University