View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10465_high_10 (Length: 263)

Name: NF10465_high_10
Description: NF10465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10465_high_10
NF10465_high_10
[»] chr2 (1 HSPs)
chr2 (1-263)||(42708762-42709022)


Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 42709022 - 42708762
Alignment:
1 ggagtagcattgcttggagcaggagaggacccagatggtttacccttaggagttttagggttttgaccaggaaaaacattcaaattccgccatttatcct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42709022 ggagtagcattgcttggagcaggagaggacccagatggtttacccttaggagttttagggttttgaccaggaaaaacattcaaattccgccatttatcct 42708923  T
101 gaacaaaaaatcaatcataaacatgataaataaaattgaattaatttcacaaacataaacaggacccnnnnnnnnnnnntcatt-ataaacacaaattga 199  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||            ||||| |||||||||||||||    
42708922 gaacaaaaaatcaatcataaacatgataaacaaaattgaattaatttcacaaacataaacaggaccc--aaaaaaaaaatcattgataaacacaaattga 42708825  T
200 atttcacaaaaacataaaccctaaccgtaattaagggaaaaaacgaacctttagatcgatattg 263  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
42708824 atttcacaaaaacataaaccctaaccgtaatt-agggaaaaaacgaacctttagatcgatattg 42708762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University