View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10465_low_16 (Length: 203)
Name: NF10465_low_16
Description: NF10465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10465_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 23 - 190
Target Start/End: Original strand, 10360418 - 10360585
Alignment:
| Q |
23 |
gagctcattgtctactttgaatctgatcacttgatttgtaagcaatatacaatttaattaacaatgtttaatttctcccttcatttaacgtcctgattca |
122 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10360418 |
gagctcattgactactttgaatctgatcacttggtttgtaagcaatatacaatttaattaacaatgtttaatttctcccttcatttaacgtcctgattca |
10360517 |
T |
 |
| Q |
123 |
tatttatatgtttaccgctattttgtcctcctattgagagcactatgcatcactttgcttcttctcac |
190 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10360518 |
tatttatatgtttaccgctattttgtgctcctattgagagcactatgcatcactttgcttcttatcac |
10360585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University