View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_high_54 (Length: 263)
Name: NF10466_high_54
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_high_54 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 18 - 146
Target Start/End: Original strand, 26976241 - 26976369
Alignment:
| Q |
18 |
ttttttctcttcatttttcttcatctgggattttgaatgtatagttttgtcaattgcataatttattactttggtcatgcatcatgagggacgtaattgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
26976241 |
ttttttctcttcatttttcttcatctgggattttgaatgtatagttttgtcaattgcataatttattactttggtcatgcatcatgatgaacgtaattgt |
26976340 |
T |
|
| Q |
118 |
atgtgaacttttaactgcaaaatactctt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26976341 |
atgtgaacttttaactgcaaaatactctt |
26976369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 31 - 140
Target Start/End: Complemental strand, 27090435 - 27090321
Alignment:
| Q |
31 |
tttttcttcatctgggattttgaatgtatagttttgtcaattgcata------atttattactttggtcatgcatcatgagggacgtaattgtatgtgaa |
124 |
Q |
| |
|
||||||||| |||||||||||||||||| | |||||||||||||||| ||||||||||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
27090435 |
tttttcttcttctgggattttgaatgtaca-ttttgtcaattgcatattttatatttattactttgttcatgcatcatcatggacgtaattgtatgtgaa |
27090337 |
T |
|
| Q |
125 |
cttttaactgcaaaat |
140 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
27090336 |
ctttaaactgcaaaat |
27090321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 18 - 143
Target Start/End: Original strand, 34678648 - 34678768
Alignment:
| Q |
18 |
ttttttctcttcatttttcttcatctgggattttgaatgtatagttttgtcaattgcataatttattactttggtc-atgcatcatgagggacgtaattg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||| | |||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
34678648 |
ttttttctcttcatttttcttcatctgggatttc-----tat-gttgtcacaattgcataatttattactttggtccatgcatcatgatggacgtaattg |
34678741 |
T |
|
| Q |
117 |
tatgtgaacttttaactgcaaaatact |
143 |
Q |
| |
|
||||| ||||||||||||||||||||| |
|
|
| T |
34678742 |
tatgtaaacttttaactgcaaaatact |
34678768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University