View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_high_71 (Length: 241)
Name: NF10466_high_71
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_high_71 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 19640972 - 19641195
Alignment:
| Q |
18 |
actatagtccataattccctcctgttccagaagctcacagtcccggtcgatttgcctgtgatcgtatataacaaacacacgaattgcttcaattgcttat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || || ||||||| ||||| |
|
|
| T |
19640972 |
actatagtccataattccctcctgttccagaagctcacagtcccggtcgatttgcctgtgatcatatataacaaacacatgacatggttcaatttcttat |
19641071 |
T |
|
| Q |
118 |
tcttttcgagaaggtaaaaatagaaatctgttatatgatagctagataggtcacgttaaaatttgctatcatatatttaacttttatcacctgcaaaatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19641072 |
tcttttcgagaaggtaaaaatagaaatttgttatatgatagctagctaggtcatgttaaaatttgctataatatatttaacttttatcacctgcaaaatt |
19641171 |
T |
|
| Q |
218 |
ctaaaaaccaagatcgttgtagtc |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
19641172 |
ctaaaaaccaagatcgttgtagtc |
19641195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 56
Target Start/End: Complemental strand, 35259205 - 35259167
Alignment:
| Q |
18 |
actatagtccataattccctcctgttccagaagctcaca |
56 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
35259205 |
actatagtccataattccctcttgttctagaagctcaca |
35259167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University