View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_high_78 (Length: 238)
Name: NF10466_high_78
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_high_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 2 - 225
Target Start/End: Complemental strand, 11345207 - 11344984
Alignment:
| Q |
2 |
agttctacatgaggtgcagccttgccagcacaaacaccttgtggttggtgaatgagatgcttggattcttcttcaccatatgtttgaaaaggatggctaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11345207 |
agttctacatgaggtgcagccttgccaacacaaacaccttgtggttggtgaatgagatgcttggattcttcttcaccatatgtttgaaaaggatggctaa |
11345108 |
T |
|
| Q |
102 |
tggttttttgcattggatcatacagcgttaggaatgtcaatgaagaacatgcttctgtcatccctttgataaatgaaaattgttactgattatgagacca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11345107 |
tggttttttgcattggatcatacagcgttaggaatgtcaatgaagaacatgcttctgtcatccctttgataaatgaaaattgttactgattatgagacca |
11345008 |
T |
|
| Q |
202 |
aatgaacttgctacatgtaaaaat |
225 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11345007 |
aatgaacttgctacatgtaaaaat |
11344984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University