View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_high_88 (Length: 211)
Name: NF10466_high_88
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_high_88 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 34046725 - 34046541
Alignment:
| Q |
18 |
aagatgttgacgacaagataaaattctacc-gtggaagtggtttcttagaagactttcagttattcttgtaattagtatgactgaaagatgaaacctatt |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
34046725 |
aagatgctgacgacaagataaaattctacccgtggaagtggtttcttagaagactttcggttattcttgtaatcagtatgagtgaaagatgaaacctatt |
34046626 |
T |
 |
| Q |
117 |
ttatgtaggattacaatagtcggtgagaacaactatgaaaggctgaactacactcatcggtcatcgccatttagtttcacaggtt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34046625 |
ttatgtaggattacaatagtcggtgagaacaactatgaaaggctgaactacactcattggtcatcgccatttagtttcacaggtt |
34046541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University