View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_low_100 (Length: 218)
Name: NF10466_low_100
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_low_100 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 44695362 - 44695548
Alignment:
| Q |
1 |
cttcaccctgtgaatggttcatatgcgatgacaatcatagttctacgagatattttgttattcaggtgtggaaaattaaaaggggatatcctattatctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44695362 |
cttcaccctgtgaatggttcatatgcgatgacgatcgtagttctacgagatattttgttattcaggtgtggaaaattaaaaggggatatcctattatctt |
44695461 |
T |
|
| Q |
101 |
gcaatataacacatatttatttctttctttcaaccgtgttattattcacataacatattagtaagttagcattaaaaatgattgcaaatttgga |
194 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44695462 |
gcaat---tcacatattta----tttctttcaaccgtgttattattcacataacatattagtaagttagcattaaaaatgattgcaaatttgga |
44695548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University