View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_low_104 (Length: 209)
Name: NF10466_low_104
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_low_104 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 34866135 - 34865927
Alignment:
| Q |
1 |
agttgaccattagtagcggttcatacactcgaaagattccaatataggaatttcaaattgttgcgtttttatatgcaggtgctcattaaccaactcaaag |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34866135 |
agttgaccattagtagcgggtcatacactcgaaagattccaatataggaatttcaaattgttgcgtttttatatgcaggtgctcattaaccaactcaaag |
34866036 |
T |
|
| Q |
101 |
acattgcattaacaagtcagaagtccatatcagagtgtgcagaaaaggggagctacttggcctccagacagacaatctttctgataaagaaatctttgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34866035 |
acattgcattaacaagtcagaagtccatatcagagtgtgcagaaaaggggagctacttggcctccagacagacaatctttctgataaagaaatctttgga |
34865936 |
T |
|
| Q |
201 |
ggctccttc |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
34865935 |
ggctccttc |
34865927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 57 - 166
Target Start/End: Complemental strand, 7948291 - 7948181
Alignment:
| Q |
57 |
attgttgcgttttt-atatgcaggtgctcattaaccaactcaaagacattgcattaacaagtcagaagtccatatcagagtgtgcagaaaaggggagcta |
155 |
Q |
| |
|
|||||||| ||||| || |||||||||| || ||||||||||||||| |||| ||||| |||||||||||||||||||||| ||||||| | || || |
|
|
| T |
7948291 |
attgttgcctttttcatttgcaggtgcttatcaaccaactcaaagacgttgccccaacaattcagaagtccatatcagagtgtacagaaaaagtgaactg |
7948192 |
T |
|
| Q |
156 |
cttggcctcca |
166 |
Q |
| |
|
||||||||||| |
|
|
| T |
7948191 |
cttggcctcca |
7948181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University