View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10466_low_2 (Length: 813)

Name: NF10466_low_2
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10466_low_2
NF10466_low_2
[»] chr5 (1 HSPs)
chr5 (155-235)||(42438752-42438833)
[»] chr3 (3 HSPs)
chr3 (704-751)||(31695189-31695237)
chr3 (703-750)||(31877690-31877738)
chr3 (704-751)||(31938997-31939045)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 2e-26; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 155 - 235
Target Start/End: Complemental strand, 42438833 - 42438752
Alignment:
155 ggaggttttggctctaacggcggcattgacggcgtcttcgagcttacgggaaagcatgta-taatcaaggtattcttgaacg 235  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||| ||||||||||||    
42438833 ggaggttttggctctaacggcggcattgacggcgtcttcgagtttacgggaaagcatgtatttatcaagatattcttgaacg 42438752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.00000000002; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 704 - 751
Target Start/End: Complemental strand, 31695237 - 31695189
Alignment:
704 attatccttgtacaagtttatagagaaa-tttagaggttctatgcatta 751  Q
    ||||||||||| |||||||||||||||| ||||||||||||||||||||    
31695237 attatccttgtgcaagtttatagagaaattttagaggttctatgcatta 31695189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 703 - 750
Target Start/End: Original strand, 31877690 - 31877738
Alignment:
703 gattatccttgtacaagtttatagagaaa-tttagaggttctatgcatt 750  Q
    ||||||||||||||||||||||||||||| |||||||||| ||||||||    
31877690 gattatccttgtacaagtttatagagaaattttagaggttgtatgcatt 31877738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 704 - 751
Target Start/End: Original strand, 31938997 - 31939045
Alignment:
704 attatccttgtacaagtttatagagaaa-tttagaggttctatgcatta 751  Q
    ||||||||||| |||||||||||||||| ||||||||||||||||||||    
31938997 attatccttgtgcaagtttatagagaaattttagaggttctatgcatta 31939045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University