View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_low_29 (Length: 373)
Name: NF10466_low_29
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 18 - 363
Target Start/End: Original strand, 4642759 - 4643104
Alignment:
| Q |
18 |
ataatgaaagtttatggatcaaattgaagatttactcttgattatatgatatgatgtttaaataatataaattgactgagaattttgtctgggagatagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4642759 |
ataatgaaagtttatggatcaaattgaagatttactcttgattatatgatatgatgtttaaataatagaaattgactgagaattttgtctgggagatagt |
4642858 |
T |
 |
| Q |
118 |
ttgatttaaatattcagtagctttcctagtatttgaatgttgttcttcatgtaaggatttgattcacgaaatatttaattgatctcagtatttacttatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4642859 |
ttgatttaaatattcagtagctttcctagtatttgaatgttgttcttcatgtaaggatttgattcacgaaatatttaattgatctcagtatttacttatt |
4642958 |
T |
 |
| Q |
218 |
actttgtatcccttgctttttcttgactgtttaagttggtaattctggtttatgcgatttcattctctttaggctgcaaaggtgttcttcacagctcctt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4642959 |
actttgtatcccttgctttttcttgactgtttaagttggtaattctggtttatgcgatttcattctctttaggctgcaaaggtgttcttcacagctcctt |
4643058 |
T |
 |
| Q |
318 |
gtttattgtgggagagataggaggcaatgactatggttttcctttg |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4643059 |
gtttattgtgggagagataggaggcaatgactatggttttcctttg |
4643104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University