View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_low_33 (Length: 361)
Name: NF10466_low_33
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_low_33 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 15 - 361
Target Start/End: Original strand, 2488370 - 2488717
Alignment:
| Q |
15 |
actttattcttcaattattgatattctagtaataaaatatggcaccatatcactgattgattataatatttttgatacaggaaatggtttattttcttgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2488370 |
actttattcttcaattattgatattctagtaataaaatatggcaccatatcattgattgattataatatttttgatacaggaaatggtttattttcttgt |
2488469 |
T |
|
| Q |
115 |
tgatatttgggagcaagagggtctata----tgattgataaagcaaaaataggcatttgttcattctcctattggatggataattgtaaatggtgtaact |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2488470 |
tgatatttgggagcaagagggtctatatgattgattgataaagc-aaaatagacatttcttcattctcctattggatggataattgtaaatggtgtaact |
2488568 |
T |
|
| Q |
211 |
cttgcaaactattttgattttaattactaattggtaacaagaaatttaatcaatgtaaagaattag-nnnnnnnaggaagtagttaaattacttgttaac |
309 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2488569 |
cttgcaaactattttgattttaattac---ttggtaacaagaaatttaatcaatgtaaagaattagttttttttaggaagtagttaaattacttgttaac |
2488665 |
T |
|
| Q |
310 |
atcgattattatatggtttcagttattgattttaacggatcaagttcatctc |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2488666 |
atcgattattatatggtttcagttattgattttaacggatcaagttgatctc |
2488717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University