View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10466_low_49 (Length: 302)
Name: NF10466_low_49
Description: NF10466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10466_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 119 - 211
Target Start/End: Original strand, 5103187 - 5103279
Alignment:
| Q |
119 |
aaatattcatctataaaaaatgattttgaagacaagctaatcactatagctttccattttgcaatttttagattattttttcctttcaaaagc |
211 |
Q |
| |
|
||||| |||| | ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5103187 |
aaataatcatatgtaaaaaaagattttgaagacaagctactcactatagctttccattttgcaatttttagattattttttcctttcaaaagc |
5103279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 5103038 - 5103078
Alignment:
| Q |
1 |
agattccacaggatgttaaaggtgaaattatggtcactatt |
41 |
Q |
| |
|
||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
5103038 |
agattacacacgatgttaaacgtgaaattatggtcactatt |
5103078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University